.. _quickstart: ---------- Quickstart ---------- Here is a quick tutorial covering GenomeKit's most important functionality. Installation ------------ Install via conda ~~~~~~~~~~~~~~~~~ The best way to install GenomeKit is via the pre-compiled conda packages available from https://anaconda.org/conda-forge/genomekit. You can install GenomeKit with:: conda install -c conda-forge genomekit Basics ------ Initial Data Access ~~~~~~~~~~~~~~~~~~~ Data, such as assemblies, annotations, tracks, etc, are stored in custom-built binary files. These files back GenomeKit objects and are required to query the genomic sequences and locations you are interested in. APIs for building these files are provided as part of the API. ``starter/build.sh`` is a bash script that builds a few assemblies and annotations and places them in the local data directory, to get you started. It also serves as a good example of how to build your own data files. A larger selection of pre-built data files is provided in a public Google Cloud Storage bucket, which is set as the default data source. The bucket is configured with `"requester pays" `__ enabled, so you will need to - `install gcloud `__ - set up your `gcloud credentials `__:: gcloud auth application-default login - set the ``GENOMEKIT_GCS_BILLING_PROJECT`` env var to your Google Cloud project:: export GENOMEKIT_GCS_BILLING_PROJECT="your-project-id" For more details on creating your own data source, see `the section on Sharing data files `_. Import the :py:mod:`genome_kit` package into your project:: >>> import genome_kit as gk For brevity, this tutorial assumes you've imported several core types directly into your namespace:: >>> from genome_kit import Genome >>> from genome_kit import Interval ... Most GenomeKit code will need two core object types: - :py:class:`~genome_kit.Interval` - an interval on a reference genome - :py:class:`~genome_kit.Genome` - resources available for a reference genome An `interval` is initialized from five values: `chromosome`, `strand`, `start`, `end`, and `reference_genome` >>> interval = Interval("chr7", "+", 117120016, 117120201, "hg19") Irrespective of strand, an interval always has `start <= end`. The span of an interval excludes the `end` position, so the number of bases spanned by an interval is `end -- start`. >>> len(interval) 185 GenomeKit intervals can be described as "0-based, exclusive end", whereas UCSC browser positions are "1-based, inclusive end":: >>> interval.as_ucsc() 'chr7:117120017-117120201' A `genome` provides convenient access to resources associated with a reference genome:: >>> genome = Genome("hg19") # Equivalently "hg19" >>> genome.dna(interval) 'AATTGGAAGCAAA...AACTTTTTTTCAG' Some resources are versioned and are only accessible if the intended version is unambiguous from the configuration strings. For example, specifying a GENCODE version enables annotations:: >>> genome = Genome("gencode.v19") # Implies "hg19" >>> gene = genome.genes["ENSG00000001626.10"] # Gene object >>> tran = gene.transcripts[2] # Transcript object >>> exon = tran.exons[0] # Exon object >>> genome.dna(exon) 'AATTGGAAGCAAA...AACTTTTTTTCAG' The above exon has the same interval that we defined earlier, plus several other attributes:: >>> exon.interval Interval("chr7", "+", 117120016, 117120201, "hg19") >>> exon.index 0 >>> exon.transcript >>> exon.cds >>> exon.next_exon Tracks ------ GenomeKit users can also build tracks via :py:class:`~genome_kit.GenomeTrackBuilder`. .. note:: When building a track, data is ordered according to the strandedness argument passed to the builder's constructor: * ``"single_stranded"``: both strands share the same data. The data is applied in Interval coordinate (reference strand) order. * ``"strand_unaware"``: ignores the Interval strand, data is applied in Interval coordinate (reference strand) order. * ``"strand_aware"``: data is applied from 5" end to 3" end (sense strand order). >>> track = GenomeTrackBuilder("neg.gtrack", "u3", "strand_unaware", Genome("hg19")) >>> interval = Interval("chr1", "-", 10, 15, "hg38") >>> track.set_data(interval, np.arange(0, len(interval), dtype=np.uint8)) >>> track.finalize() >>> track = GenomeTrack("neg.gtrack") >>> track(interval) array([[4], [3], [2], [1], [0]], dtype=uint8) >>> track = GenomeTrackBuilder("neg.gtrack", "u3", "strand_aware", Genome("hg19")) >>> track.set_data(interval, np.arange(0, len(interval), dtype=np.uint8)) >>> track.finalize() >>> track = GenomeTrack("neg.gtrack") >>> track(interval) array([[0], [1], [2], [3], [4]], dtype=uint8) Annotations ----------- GenomeKit provides access to GENCODE and RefSeq annotations. Walking the structure of an annotation is straight-forward:: genome = Genome("gencode.v19") for gene in genome.genes: # Each gene print(gene) for tran in gene.transcripts: # Each transcript on the gene print(" ", tran) for exon in tran.exons: # Each exon on the transcript print(" ", exon) You can run the above example from the GenomeKit directory:: $ python demos/walk_annotations.py ... Annotations are accessible via following attributes: :py:attr:`~.genome_kit.Genome.genes`, :py:attr:`~.genome_kit.Genome.transcripts`, :py:attr:`~.genome_kit.Genome.exons`, :py:attr:`~.genome_kit.Genome.introns`, and :py:attr:`~.genome_kit.Genome.cdss`. Each of these can be thought of as an indexed table, like in a database. For example, `exons` is an instance of type :py:class:`~.genome_kit.ExonTable` and each row in that table is an instance of :py:class:`~.genome_kit.Exon`, with the fields you'd expect. Most importantly, each annotation table is indexed for fast positional queries:: >>> # First exon of a CFTR transcript >>> exon = genome.transcripts["ENST00000003084.6"].exons[0] >>> genome.exons.find_overlapping(exon) [, , ] The following methods take a single `interval` argument and are available for every element table: - :py:meth:`~genome_kit.ExonTable.find_overlapping` - elements overlapping `interval`. - :py:meth:`~genome_kit.ExonTable.find_within` - elements falling within `interval`. - :py:meth:`~genome_kit.ExonTable.find_exact` - elements exactly spanning `interval`. - :py:meth:`~genome_kit.ExonTable.find_5p_aligned` - elements with 5' end aligned to the 5' end of `interval`. - :py:meth:`~genome_kit.ExonTable.find_3p_aligned` - elements with 3' end aligned to the 3' end of `interval`. - :py:meth:`~genome_kit.ExonTable.find_5p_within` - elements with 5'-most position within `interval`. - :py:meth:`~genome_kit.ExonTable.find_3p_within` - elements with 3'-most position within `interval`. These methods are useful for mapping positions to annotation elements. See :py:class:`~.genome_kit.GenomeAnnotation` for the top-level object that ultimately owns all the annotation tables. Working with Intervals ---------------------- GenomeKit uses the following convention for :py:class:`~genome_kit.Interval`: 1. intervals are always stranded (+ or --), 2. positions are internally 0-based, and 3. the span of an interval excludes its `end` position. Intervals are initialized using what is called the `DNA0` convention where, irrespective of strand, where `start <= end`. Intervals can be empty (`start == end`). The resulting interval spans the same positions in the genome as a Python slice operation `[start:end]`. For example, an interval with `start=3` and `end=7` spans the four over-lined positions below, irrespective of strand:: [__________] 0 1 2 3 4 5 6 7 8 9 10 To see what we can do with intervals, let's create a few:: >>> # 0123456789 >>> # aaaaabbbbb >>> # cccc >>> # d >>> a = Interval("chr1", "+", 0, 5, "hg38") >>> b = Interval("chr1", "+", 5, 10, "hg38") >>> c = Interval("chr1", "+", 3, 7, "hg38") >>> d = Interval("chr1", "+", 3, 4, "hg38") >>> len(a), len(b), len(c), len(d) (5, 5, 4, 1) >>> a.contains(c), c.within(a), a.contains(d), d.within(a) (False, False, True, True) >>> a.overlaps(b), a.overlaps(c) (False, True) >>> a.upstream_of(b), b.dnstream_of(a) (True, True) >>> c.upstream_of(b), b.dnstream_of(c) (False, False) >>> a == b, a == d (False, False) >>> a != b, a != d (True, True) Intervals on opposite strands effectively live in different universes:: >>> # 0123456789 >>> # xxxxxyyyyy >>> # zzzz >>> # w >>> x = a.as_opposite_strand() >>> y = b.as_opposite_strand() >>> z = c.as_opposite_strand() >>> w = d.as_opposite_strand() >>> x Interval("chr1", "-", 0, 5, "hg38") >>> y Interval("chr1", "-", 5, 10, "hg38") >>> z Interval("chr1", "-", 3, 7, "hg38") >>> w Interval("chr1", "-", 3, 4, "hg38") >>> x.overlaps(d) # opposite strands False >>> x.contains(d) # opposite strands False >>> x.contains(w) True >>> x.upstream_of(y), y.upstream_of(x) (False, True) >>> x == a # opposite strands False Given an interval, you can also build new intervals centered around its 5' end (upstream) and 3' end (downstream), which depends on strand:: >>> interval = Interval("chr1", "-", 4, 8, "hg38") >>> interval.end5 Interval("chr1", "-", 8, 8, "hg38") >>> interval.end3 Interval("chr1", "-", 4, 4, "hg38") >>> interval.end3.expand(2, 3) Interval("chr1", "-", 1, 6, "hg38") Notice that the `end5` and `end3` attributes return empty (length-0) intervals. This is a general convention in GenomeKit: *an empty interval denotes the space between two consecutive positions in the genome*. This convention is useful for defining alignments or defining new intervals relative to the empty one via :py:meth:`~genome_kit.Interval.expand`. For example, the intervals in the above code example can be visualized as follows:: [__________] # Interval("chr1", "-", 4, 8, "hg38") 0 1 2 3 4 5 6 7 8 9 10 [] # interval.end5 0 1 2 3 4 5 6 7 8 9 10 [] # interval.end3 0 1 2 3 4 5 6 7 8 9 10 [_____________] # interval.end3.expand(2, 3) 0 1 2 3 4 5 6 7 8 9 10 Feature extraction basics ------------------------- GenomeKit currently provides DNA sequence, accessible via the `dna` attribute of :py:class:`.Genome`. The extracted DNA is automatically reverse-complemented according to strand:: >>> a = Interval("chr7", "+", 117120016, 117120201, "hg19") >>> b = a.as_opposite_strand() >>> genome = Genome("hg19") >>> genome.dna(a) 'AATTGGAAGCAAA...AACTTTTTTTCAG' >>> genome.dna(b) 'CTGAAAAAAAGTT...TTTGCTTCCAATT' GenomeKit makes it easy to extract features that correspond to annotated elements, and to filter those elements by their attributes. For example, we could extract DNA from all acceptor sites that meet certain criteria:: def has_coding_seq(e): return e.cds is not None # Has CDS? def has_good_level(e): return e.tran.level <= 2 # Is level 1 or 2? def not_first_exon(e): return e.index > 0 # Is not first exon? genome = Genome("gencode.v19") # 1196293 exons exons = filter(has_coding_seq, genome.exons) # 724078 remaining exons = filter(has_good_level, exons) # 605573 remaining exons = filter(not_first_exon, exons) # 558099 remaining sites = set(exon.end5 for exon in exons) # 198992 unique for site in sites: print(genome.dna(site.expand(5, 5))) The above outputs the following 10nt sequences surrounding acceptor sites:: TGCAGGGAAC # Note they are all sense-strand (AG) TTCAGCTGCT # because exon.end5 knows the strand. TGTAGGAAAC TCCAGGCTAT GCCAGAGGAC GACAGAACCA CCCAGATTGG ... GenomeKit also make it easy to map positions to the nearest annotated element. For example, we could map branch sites to their nearest downstream acceptor site:: genome = Genome("gencode.v19") # We want to map each of these to an acceptor at most 100nt downstream coords = [ Interval.from_dna0_coord("chr1", "-", 91661, "hg19"), Interval.from_dna0_coord("chr1", "-", 169295, "hg19"), Interval.from_dna0_coord("chr1", "+", 320861, "hg19") ] for coord in coords: window = coord.expand(0, 100) # Find all exons with exons = genome.exons.find_5p_within(window) # acceptor in window for exon in exons: print(coord.as_ucsc(), "-->", exon) The above outputs the following mappings:: chr1:91662-91662 --> chr1:169296-169296 --> chr1:320862-320862 --> # 1st candidate chr1:320862-320862 --> # 2nd candidate chr1:320862-320862 --> # 3rd candidate Variants -------- Individual genomic variants are represented by a :py:class:`~.Variant`:: from genome_kit import Variant A variant is defined by a chromosome, 0-based position (DNA0), reference allele, alternate allele, and reference genome:: >>> variant = Variant("chr7", 117120148, "AT", "G", "hg19") >>> variant A variant is a subclass of :py:class:`~.Interval`, and also has an :py:attr:`~.Variant.interval` attribute. The interval spans the reference allele:: >>> variant.start, variant.end, len(variant) (117120148, 117120150, 2) >>> variant.interval Interval("chr7", "+", 117120148, 117120150, "hg19") Variants may also be created from a string where the position is 1-based (DNA1), which is the convention of UCSC and Clinvar:: >>> genome = Genome("hg19") >>> variant = genome.variant("chr7:117,120,149:AT:G") # First way >>> variant = Variant.from_string('chr7:117,120,149:AT:G', genome) # Second way >>> variant A variant created from a string is always validated against the reference genome, raising an exception if the reference allele does not match. ENSEMBL-style chromosome names (without leading ``chr``) are also allowed and are automatically converted. The GenomeKit variant format includes, but is more general than, the Clinvar variant convention when it comes to insertion and deletions. Clinvar does not allow an empty ref or alt allele (requiring the allele before the indel to be repeated), while empty alleles are allowed in GenomeKit. For example, the variants ``chr7:117,120,150:A:-`` and ``chr7:117,120,149:CA:C`` are interpreted identically by GenomeKit. Empty alleles can be specified by ``""``, ``"-"``, or ``"."``. Variants from VCF Files ----------------------- GenomeKit provides a binary VCF format that is compact, indexed by position. The binary files can be opened by :py:class:`~genome_kit.VCFTable`, which returns convenient :py:class:`~.Variant`-based objects:: >>> from genome_kit import VCFTable Suppose you have the following VCF saved as ``test.vcf.gz``:: ##fileformat=VCFv4.2 ##reference=GRCh37 ##INFO= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample1 sample2 sample3 1 949523 . C T . . AF=0.00 GT:AD 0/0:0,1 0/1:0,2 0/0:0,3 1 949608 . G A . . AF=0.01 GT:AD 0/0:0,4 0/1:0,5 0/0:0,6 1 949696 . - G . . AF=0.02 GT:AD 0/0:0,7 0/1:0,8 0/1:0,9 1 949739 . G TC . . AF=0.03 GT:AD 0/1:0,10 0/0:0,11 1/1:0,12 1 977028 . G T . . AF=0.04 GT:AD 0/1:0,13 0/0:0,14 1/1:0,15 1 977330 . T C . . AF=0.05 GT:AD 0/1:0,16 0/0:0,17 ./.:0,18 1 977516 . - C . . AF=0.06 GT:AD 1/1:0,19 1/1:0,20 ./.:0,21 1 977570 . G A . . AF=0.07 GT:AD 1/1:0,22 1/1:0,23 ./.:0,24 1 978604 . CT - . . AF=0.08 GT:AD 1/1:0,25 1/1:0,26 ./.:0,27 1 978628 . C T . . AF=0.09 GT:AD ./.:28,0 0/0:29,0 ./.:30,0 Open the VCF, making sure to carry over the `AF`, `GT`, and `AD` data:: >>> vcf = VCFTable.from_vcf("test.vcf.gz", Genome("hg19"), info_ids=["AF"], fmt_ids=["GT", "AD"]) >>> vcf >>> vcf[0] Get a variant's INFO attribute:: >>> vcf[5].AF 0.0500000007451 >>> vcf.info("AF") array([ 0. , 0.01, 0.02, ..., 0.07, 0.08, 0.09], dtype=float32) Query an interval:: >>> interval = vcf[5].expand(300, 300) # chr1:977030-977630 >>> variants = vcf.find_within(interval) >>> variants [, , ] Get indices of variants returned by a query:: >>> indices = [vcf.index_of(v) for v in variants] >>> indices [5, 6, 7] Get per-sample genotype and allelic depth for specific variants:: >>> gt = vcf.format('GT') >>> gt.shape (10L, 3L) >>> gt[indices] array([[1, 0, 0], [2, 2, 0], [2, 2, 0]], dtype=int8) >>> ad = vcf.format('AD') >>> ad.shape (10L, 3L) >>> ad[indices] array([[[ 0, 16], [ 0, 17], [ 0, 18]], [[ 0, 19], [ 0, 20], [ 0, 21]], [[ 0, 22], [ 0, 23], [ 0, 24]]], dtype=int32) The fastest way to filter variants by FORMAT columns is to use numpy on the entire array:: >>> mask = np.any(ad.sum(axis=2) >= 20, axis=1) # Find variants with at least one >>> variants = vcf.where(mask) # sample having ad >= 20 >>> variants [, , , ] You can run the above examples with ``$python demos/query_vcf.py`` from the GenomeKit directory. Feature Extraction with Variants -------------------------------- Besides reference genomes (:py:class:`.Genome`), GenomeKit can also represent a genome that has variants applied to it (:py:class:`.VariantGenome`). The idea is that you can pass either a reference genome or a variant genome to your feature extraction code, and both cases will work transparently. :py:class:`~.VariantGenome` will accept either a single :py:class:`.Variant` object, a variant string, or a list which can contain a mixture of both. When a `Variant` object is passed it is checked that it is defined on the same reference genome as the `VariantGenome`. When a string is supplied, as `Variant` object is created on the same reference genome as the `VariantGenome`. Consider a toy example, where the only feature we extract is the DNA sequence flanking the 5' end of a CFTR transcript:: def extract_features(genome): tran = genome.transcripts["ENST00000426809.1"] # CFTR transcript span = tran.end5.expand(2, 5) # 7nt span at 5' end return genome.dna(span) # extract DNA ref = Genome("gencode.v19") variants = [Variant.from_string("chr7:117120149:A:G", ref), # rs397508328 Variant.from_string("chr7:117120151:G:T", ref)] # rs397508657 var = VariantGenome(ref, variants) print(extract_features(ref)) print(extract_features(var)) The above outputs reference DNA, and a variant DNA:: CCATGCA CCGTTCA However, unless one plans to only support SNVs and not INDELs, it is important to specify how each query interval should be aligned with respect to insertions/deletions. Read on and learn about :py:class:`.VariantGenome` and about the concept of "anchors". Variant genomes ^^^^^^^^^^^^^^^ Variant genomes are made by applying a zero or more variants to a reference genome via the :py:class:`.VariantGenome` class. If a list of variants is given, they are `all` applied as if they were a single complex variant:: ref = Genome("hg19") var1 = VariantGenome(ref, ref.variant("chr7:117120188:A:T")) # rs397508673 (A>T) var2 = VariantGenome(ref, ref.variant("chr7:117120190:A:-")) # rs397508710 (delA) var3 = VariantGenome(ref, [ref.variant(x) for x in ["chr7:117120188:A:T", "chr7:117120190:A:-"]]) # both variants together .. note:: Variants are currently specified using string format ``chromosome:position:ref:alt`` where the position is DNA1, just like in ClinVar or the UCSC browser (technically VCF 4.0/4.1 standard). Clinvar also has a special format to denote indels that includes the preceding base as padding, such as in ``'chr7:117,231,993:TCT:T'``. GenomeKit can handle this format but it is optional. Therefore ``'chr7:117,231,994:CT:'`` would be equivalent to the previous variant. GenomeKit also allows either ``-``, or ``.`` to denote an empty *ref* or *alt* field (*e.g.* ``'chr7:117,231,994:CT:.'``). When the padding base in supplied, GenomeKit trims it off internally. GenomeKit also allows comma separators in the variant position (*e.g.* ``'117,231,993'``), as well as both UCSC (``'chr7'``) and ENSEMBL-style (``'7'``) chromosome names (only for nuclear chromosomes 1--23, X, and Y). Given a query interval, the variant genome's :py:meth:`~genome_kit.VariantGenome.dna` method returns the variant sequence, rather than the reference sequence:: >>> interval = Interval("chr7", "+", 117120185, 117120192, ref) >>> ref.dna(interval) 'CCAAACT' >>> var1.dna(interval) # (A>T) 'CCTAACT' >>> var2.dna(interval) # (delA) 'CCAACT' >>> var3.dna(interval) # (A>T, delA) 'CCTACT' Notice that when a length-changing variant falls within the query interval, the length of the result changes. This is only the default behaviour. The next section explains how to control alignment for feature extraction by 'anchoring' an interval. Length-changing variants ^^^^^^^^^^^^^^^^^^^^^^^^ Variants that insert or delete positions (INDELs) effectively change the coordinate system of the variant genome. If an interval is specified on the reference genome, and there are variants falling within that interval, then the manner in which it should be lifted to the variant genome is ambiguous. This section explains how you can control the lifting behaviour to suit your feature extraction needs. The mechanism that GenomeKit provides is `anchored` intervals. The idea is that the user indicates a position within the reference interval that remains aligned when the interval is lifted over to the variant genome. For example, you may want to anchor your interval to its 5' or 3' end:: >>> interval = Interval("chr7", "+", 117120185, 117120192, ref) >>> anchored_5p = interval.with_anchor("5p") # Anchored to its 5' end >>> anchored_3p = interval.with_anchor("3p") # Anchored to its 3' end >>> ref = Genome("hg19") >>> var = VariantGenome(ref, ref.variant("chr7:117120190:A:-")) # rs397508710 (delA) >>> ref.dna(interval) 'CCAAACT' >>> var.dna(interval) # (shrink 3' end) 'CCAACT' >>> var.dna(anchored_5p) # (fill 3' end) 'CCAACTT' >>> var.dna(anchored_3p) # (fill 5' end) 'TCCAACT' Besides the `"5p"` and `"3p"` modes, there are other ways to anchor your intervals. See :ref:`anchors` for a more in-depth explanation. Motif finding ------------- GenomeKit can find motifs in both reference and mutant sequences for you. This is based on string matching, not PWMs. The example shows how to search for motifs on both the reference and a variant genome using the :py:meth:`genome_kit.Genome.find_motif` and :py:meth:`genome_kit.VariantGenome.find_motif`:: >>> genome = Genome('hg19') >>> # Short sequence from CFTR >>> interval = Interval('chr7', '+', 117231957, 117232030, genome) >>> genome.dna(interval) 'TTGATATTTATATGTTTTTATATCTTAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTC' >>> motif = 'AACAA' >>> matches = genome.find_motif(interval, motif) >>> matches [Interval("chr7", "+", 117232009, 117232009, "hg19", 117232009)] The returned interval is empty but can be expanded for feature extraction:: >>> matches[0].expand(5, 5) Interval("chr7", "+", 117232004, 117232014, "hg19", 117232009) The returned interval always has its anchor set equal to its position. This means that the interval will always stay aligned to the same position on the reference genome when variants are applied. The default is to return the empty interval upstream of the first nucleotide of the motif matches, *i.e.* the motif is immediately downstream. But in many cases we would like to change that behaviour. For example, when we match the acceptor core splice site motif ``AG``, we usually want the match to be aligned to the 3' end of the ``AG`` motif. For this reason, :py:meth:`~genome_kit.Genome.find_motif` supports the ``match_position`` argument. The default is ``match_position=0`` (equivalently ``match_position='5p'``), which aligns the match to the 5' end of the motif. In the above case of searching for acceptor motifs, we can set ``match_position='3p'`` to return potential splice sites:: >>> motif = 'AG' >>> matches = genome.find_motif(interval, motif, match_position='3p') >>> matches [Interval("chr7", "+", 117231987, 117231987, "hg19", 117231987), Interval("chr7", "+", 117232020, 117232020, "hg19", 117232020)] We can verify that the ``AG`` is now immediately upstream of the returned empty intervals:: >>> [genome.dna(match.expand(2, 0)) for match in matches] ['AG', 'AG'] Alternatively, ``match_position`` can also be an integer: ``match_position=0`` is equivalent to ``match_position='5p'``, ``match_position=len(motif)`` is equivalent to ``match_position='3p'`` and integers within that range match positions within the motif. By default :py:meth:`~genome_kit.Genome.find_motif` returns only *non overlapping* matches, but this can be configured with the ``find_overlapping_matches`` parameter:: >>> interval = Interval('chr7', '+', 117231957, 117232030, genome) >>> motif = 'TT' >>> genome.dna(interval) 'TTGATATTTATATGTTTTTA' >>> genome.find_motif(interval, motif, find_overlapping_motifs=False) [Interval("chr7", "+", 117231957, 117231957, "hg19", 117231957), Interval("chr7", "+", 117231963, 117231963, "hg19", 117231963), Interval("chr7", "+", 117231971, 117231971, "hg19", 117231971), Interval("chr7", "+", 117231973, 117231973, "hg19", 117231973), Interval("chr7", "+", 117231981, 117231981, "hg19", 117231981), Interval("chr7", "+", 117232022, 117232022, "hg19", 117232022), Interval("chr7", "+", 117232024, 117232024, "hg19", 117232024)]] >>> genome.find_motif(interval, motif, find_overlapping_motifs=True) [Interval("chr7", "+", 117231957, 117231957, "hg19", 117231957), Interval("chr7", "+", 117231963, 117231963, "hg19", 117231963), Interval("chr7", "+", 117231964, 117231964, "hg19", 117231964), Interval("chr7", "+", 117231971, 117231971, "hg19", 117231971), Interval("chr7", "+", 117231972, 117231972, "hg19", 117231972), Interval("chr7", "+", 117231973, 117231973, "hg19", 117231973), Interval("chr7", "+", 117231974, 117231974, "hg19", 117231974), Interval("chr7", "+", 117231981, 117231981, "hg19", 117231981), Interval("chr7", "+", 117232022, 117232022, "hg19", 117232022), Interval("chr7", "+", 117232023, 117232023, "hg19", 117232023), Interval("chr7", "+", 117232024, 117232024, "hg19", 117232024)] The :py:meth:`~genome_kit.VariantGenome.find_motif` works the same on :py:class:`~genome_kit.VariantGenome` as on the reference genome:: >>> variant = genome.variant("chr7:117231980::TTAGTT") # Insertion >>> variant_genome = VariantGenome(genome, variant) >>> motif = 'AG' >>> matches = variant_genome.find_motif(interval, motif, ... match_position='3p') >>> matches [Interval("chr7", "+", 117231979, 117231979, "hg19", 117231979, 4), Interval("chr7", "+", 117231987, 117231987, "hg19", 117231987), Interval("chr7", "+", 117232020, 117232020, "hg19", 117232020)] The result are the previous two matches plus a third one where we inserted the motif into the reference sequence. This is a special case since the *position within the insertion* has no alignment to the reference genome. In this case the interval has its ``anchor_offset`` attribute set to four to indicate that the motif matches at the fourth position in the insertion. .. _sharing-data: Sharing new data files ---------------------- Data such as assemblies, annotations, tracks, etc is stored in custom-built binary files. APIs for building these files are provided as part of the API. GenomeKit first searches for data files in the directory specified by the environment variable ``GENOMEKIT_DATA_DIR``, defaulting to ``appdirs.user_data_dir("genome_kit")``. If the file is not found, by default GenomeKit attempts to download it from a public read-only Google Cloud Storage bucket. You can use your own GCS bucket by setting the environment variable ``GENOMEKIT_GCS_BUCKET``, allowing you to upload and share your data files. If you wish to use a different mechanism to store remote data files, you can provide an implementation of :py:class:`genome_kit.data_manager.DataManager` and register it: .. code-block:: python class MyDataManager(DataManager): def __init__(self, data_dir: str): ... def get_file(self, filename: str) -> str: ... def upload_file(self, filepath: str, filename: str, metadata: Dict[str, str]=None): ... gk.gk_data.data_manager = MyDataManager() # Alternatively, you can install a plugin package that advertises a DataManager implementation # endpoint under the "genomekit.plugins.data_manager" group. GenomeKit will automatically # use the plugin's data manager. # (see https://setuptools.pypa.io/en/latest/userguide/entry_point.html#entry-points-for-plugins)